miRBase entry: mmu-mir-665

Stem-loop mmu-mir-665


Accession
MI0004171
Symbol
MGI: Mir665
Description
Mus musculus mmu-mir-665 precursor miRNA mir-665
Gene
family?
RF00921; mir-665

Literature search
10 open access papers mention mmu-mir-665
(88 sentences)

Sequence

14875 reads, 172 reads per million, 72 experiments
agaacagggucuccuugAGGGGCCUCUGCCUCUAUCCAGGAUUauguuuuuaugACCAGGAGGCUGAGGUCCCUuacaggcggccucuuacucu
......(((((.((((((((((((((.((((((.....((.(((((....))))))).)))))).))))))))))).))).)))))........

Structure
--agaaca     u   -           U      AUCCA  A     u 
        ggguc ccu ugAGGGGCCUC GCCUCU     GG UUaug u
        ||||| ||| ||||||||||| ||||||     || |||||  
        uccgg gga auUCCCUGGAG CGGAGG     CC Aguau u
ucucauuc     c   c           U      ----A  -     u 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr12: 109586314-109586407 [+]
Clustered miRNAs
13 other miRNAs are < 10 kb from mmu-mir-665
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-665-5p

Accession MIMAT0017238
Description Mus musculus mmu-miR-665-5p mature miRNA
Sequence 18 - AGGGGCCUCUGCCUCUAUCCAGGAUU - 43
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-665-3p

Accession MIMAT0003733
Description Mus musculus mmu-miR-665-3p mature miRNA
Sequence 55 - ACCAGGAGGCUGAGGUCCCU - 74
Evidence experimental
MPSS [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298