![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-666 |
||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004553 (change log) | |||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir666 | |||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-666 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000782; mir-666 | |||||||||||||||||||||||||||||||||||||||||||||
Literature search |
4 open access papers mention mmu-mir-666 | |||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
-au --ug c - --a - gag - ag 5' cug uc ccug gug gagcgggc ca gcugu agcccc cu g ||| || |||| ||| |||||||| || ||||| |||||| || 3' gac ag ggac cgc cucguccg gu cgacg ucgggg ga u agc ugaa a a cua g --- c ca |
|||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-666-5p |
|
Accession | MIMAT0003737 |
Previous IDs | mmu-miR-666 |
Sequence |
19 - agcgggcacagcugugagagcc - 40 |
Deep sequencing | 12571 reads, 69 experiments |
Evidence | experimental; MPSS [1], cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-666-3p |
|
Accession | MIMAT0004823 |
Sequence |
56 - ggcugcagcgugaucgccugcu - 77 |
Deep sequencing | 3123 reads, 53 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|