miRBase entry: mmu-mir-297b

Stem-loop mmu-mir-297b


Accession
MI0004674
Symbol
MGI: Mir297b
Description
Mus musculus mmu-mir-297b precursor miRNA
Gene family
MIPF0000204; mir-297

Literature search
10 open access papers mention mmu-mir-297b
(12 sentences)

Sequence

4697 reads, 82 reads per million, 93 experiments
ucuauuugcuuguguguauAUGUAUGUGUGCAUGAACAUGUguauaugaauauacaUAUACAUACACACAUACCCAUAcaaacaugcauacaaacacacagaaaaugga
(((((((..((((((((.(((((((((.((.(((...((((((.((((.(((....))).)))).))))))...))).)).)))))))))...)))))))).)))))))

Structure
       gc        --a         G  C   AAC      a    a   u 
ucuauuu  uugugugu   uAUGUAUGU UG AUG   AUGUgu uaug aua a
|||||||  ||||||||   ||||||||| || |||   |||||| |||| |||  
agguaaa  gacacaca   auacguaca ac UAC   UACACA AUAC UAU c
       -a        aac         a  A   CCA      C    A   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 10511667-10511775 [+]
Clustered miRNAs
22 other miRNAs are < 10 kb from mmu-mir-297b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-297b-5p

Accession MIMAT0003480
Description Mus musculus mmu-miR-297b-5p mature miRNA
Sequence 20 - AUGUAUGUGUGCAUGAACAUGU - 41
Evidence experimental
MPSS [1], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-297b-3p

Accession MIMAT0004827
Description Mus musculus mmu-miR-297b-3p mature miRNA
Sequence 57 - UAUACAUACACACAUACCCAUA - 78
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771