Stem-loop sequence bta-mir-18b

AccessionMI0004732 (change log)
DescriptionBos taurus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention bta-mir-18b
(3 sentences)

Stem-loop 
   cu       --   u    c   u     uagu  ag ag 
5'   uguguua  agg gcau uag gcagu    ga  c  c
     |||||||  ||| |||| ||| |||||    ||  |   
3'   acacggu  ucc cgua auc cguca    cu  g  u
   --       cu   u    a   c     ---u  aa ac
Get sequence
Deep sequencing
4241 reads, 5.88 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18021698-18021772 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-18b
bta-mir-106achrX: 18021857-18021937 [-]
bta-mir-18bchrX: 18021698-18021772 [-]
bta-mir-20bchrX: 18021463-18021531 [-]
bta-mir-19b-2chrX: 18021338-18021420 [-]
bta-mir-92a-2chrX: 18021187-18021254 [-]
bta-mir-363chrX: 18021032-18021105 [-]
Database links

Mature sequence bta-miR-18b

Accession MIMAT0003517
Sequence

8 -  

uaaggugcaucuagugcaguua

 - 29

Get sequence
Deep sequencing3877 reads, 67 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).