![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-18b |
||||||||||||||
Accession | MI0004732 (change log) | |||||||||||||
Description | Bos taurus miR-18b stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
2 open access papers mention bta-mir-18b | |||||||||||||
Stem-loop |
cu -- u c u uagu ag ag 5' uguguua agg gcau uag gcagu ga c c ||||||| ||| |||| ||| ||||| || | 3' acacggu ucc cgua auc cguca cu g u -- cu u a c ---u aa ac |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence bta-miR-18b |
|
Accession | MIMAT0003517 |
Sequence |
8 - uaaggugcaucuagugcaguua - 29 |
Deep sequencing | 3877 reads, 67 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|