Stem-loop sequence bta-mir-145

Accession

MI0004756 (change log)

Description

Bos taurus miR-145 stem-loop

Gene family

MIPF0000079; mir-145

Literature search

19 open access papers mention bta-mir-145
(53 sentences)

Stem-loop

   c   u  u     c  uc    u  c            uagau 
5'  acc ug ccuca gg  cagu uu ccaggaaucccu     g
    ||| || ||||| ||  |||| || ||||||||||||     c
3'  ugg ac ggagu uc  guca aa gguccuuagggg     u
   u   u  u     -  uu    u  a            uagaa 

Deep sequencing

248975 reads, 1.87e+03 reads per million, 68 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr7: 63080500-63080587 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-145

• bta-mir-143: chr7: 63079071-63079171 [+]
• bta-mir-145: chr7: 63080500-63080587 [+]

Database links

• EntrezGene:MIR145
• RNAcentral:URS00004F4657_9913
• miRBase Tracker:MI0004756

Mature sequence bta-miR-145

• Accession: MIMAT0003542
• Sequence: 16 - guccaguuuucccaggaaucccu - 38
• Deep sequencing: 195193 reads, 66 experiments
• Evidence: experimental; cloned [1-3]
• Predicted targets:
  • TargetScanVert:bta-miR-145

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3. PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).