Stem-loop sequence bta-mir-205

Accession

MI0004759 (change log)

Description

Bos taurus miR-205 stem-loop

Gene family

MIPF0000058; mir-205

Literature search

16 open access papers mention bta-mir-205
(54 sentences)

Stem-loop

         uc           c        ucucg 
5' cucuug  cuucauuccac ggagucug     u
   ||||||  ||||||||||| ||||||||     a
3' gaggac  gaagugaggug cuuuagac     c
         uu           a        caacc 

Deep sequencing

214266 reads, 3.5e+03 reads per million, 45 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr16: 76053046-76053114 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR205
• RNAcentral:URS000075D739_9913
• miRBase Tracker:MI0004759

Mature sequence bta-miR-205

• Accession: MIMAT0003545
• Sequence: 7 - uccuucauuccaccggagucug - 28
• Deep sequencing: 214182 reads, 44 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-205

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).