![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-205 |
|||||
Accession | MI0004759 (change log) | ||||
Description | Bos taurus miR-205 stem-loop | ||||
Gene family | MIPF0000058; mir-205 | ||||
Literature search |
![]()
16 open access papers mention bta-mir-205 | ||||
Stem-loop |
uc c ucucg 5' cucuug cuucauuccac ggagucug u |||||| ||||||||||| |||||||| a 3' gaggac gaagugaggug cuuuagac c uu a caacc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-205 |
|
Accession | MIMAT0003545 |
Sequence |
7 - uccuucauuccaccggagucug - 28 |
Deep sequencing | 214182 reads, 44 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|