Stem-loop sequence bta-mir-27b

Accession

MI0004760 (change log)

Description

Bos taurus miR-27b stem-loop

Gene family

MIPF0000036; mir-27

Literature search

35 open access papers mention bta-mir-27b
(110 sentences)

Stem-loop

   -    -    gacg                  auug        ugac     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     

Deep sequencing

2538749 reads, 2.57e+04 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr8: 83483816-83483912 [+]
• Overlapping transcripts:

  sense

  ENSBTAT00000065565 ; intron 6

Clustered miRNAs

< 10kb from bta-mir-27b

• bta-mir-2475: chr8: 83482947-83483017 [+]
• bta-mir-10174: chr8: 83483597-83483678 [+]
• bta-mir-27b: chr8: 83483816-83483912 [+]
• bta-mir-24-1: chr8: 83484370-83484437 [+]

Database links

• EntrezGene:MIR27B
• RNAcentral:URS000075AF19_9913
• miRBase Tracker:MI0004760

Mature sequence bta-miR-27b

• Accession: MIMAT0003546
• Sequence: 61 - uucacaguggcuaaguucugc - 81
• Deep sequencing: 2536578 reads, 78 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-27b

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).