![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-34b |
||||||
Accession | MI0004763 (change log) | |||||
Description | Bos taurus miR-34b stem-loop | |||||
Gene family | MIPF0000039; mir-34 | |||||
Literature search |
![]()
9 open access papers mention bta-mir-34b | |||||
Stem-loop |
cg -gua u c cu u 5' gugcu guuu ggcagug aauuag ugauugua c c ||||| |||| ||||||| |||||| |||||||| | 3' cacgg caaa ccgucac uugauc acuaacau g a aa acua c - uc u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence bta-miR-34b |
|
Accession | MIMAT0003549 |
Sequence |
14 - aggcaguguaauuagcugauug - 35 |
Deep sequencing | 407 reads, 52 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|