![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-186 |
|||||
Accession | MI0005033 (change log) | ||||
Description | Bos taurus miR-186 stem-loop | ||||
Gene family | MIPF0000109; mir-186 | ||||
Literature search |
![]()
6 open access papers mention bta-mir-186 | ||||
Stem-loop |
u u u u ucu uu 5' gcuua aacuuuccaaagaauuc ccuuu gggcuu ga u ||||| ||||||||||||||||| ||||| |||||| || 3' cgagu uugaaggguuuuuuaag ggaaa cccgaa uu u u - u - --u ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-186 |
|
Accession | MIMAT0003818 |
Sequence |
15 - caaagaauucuccuuuugggcu - 36 |
Deep sequencing | 476896 reads, 78 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|