Stem-loop sequence bta-mir-186

AccessionMI0005033 (change log)
DescriptionBos taurus miR-186 stem-loop
Gene family MIPF0000109; mir-186
Literature search

6 open access papers mention bta-mir-186
(14 sentences)

Stem-loop 
   u     u                 u     u      ucu  uu 
5'  gcuua aacuuuccaaagaauuc ccuuu gggcuu   ga  u
    ||||| ||||||||||||||||| ||||| ||||||   ||   
3'  cgagu uugaaggguuuuuuaag ggaaa cccgaa   uu  u
   u     -                 u     -      --u  ua
Get sequence
Deep sequencing
476978 reads, 8.75e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 74749203-74749288 [+]
sense
ENSBTAT00000003402 ; ZRANB2-201; intron 8
Database links

Mature sequence bta-miR-186

Accession MIMAT0003818
Sequence

15 -  

caaagaauucuccuuuugggcu

 - 36

Get sequence
Deep sequencing476896 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).