Stem-loop sequence bta-let-7a-1

Accession

MI0005057 (change log)

Previous IDs

bta-let-7a

Description

Bos taurus let-7a-1 stem-loop

Gene family

MIPF0000002; let-7

Literature search

63 open access papers mention bta-let-7a-1
(270 sentences)

Stem-loop

        u   gu                uuagggucacac 
5' uggga gag  aguagguuguauaguu            c
   ||||| |||  ||||||||||||||||            c
3' auccu uuc  ucaucuaacauaucaa            a
        -   ug                uagagggucacc 

Deep sequencing

7468862 reads, 3.42e+04 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr8: 87363854-87363933 [+]
• Overlapping transcripts:

  sense

  ENSBTAT00000042360 ; bta-let-7a-1-201; exon 1

Clustered miRNAs

< 10kb from bta-let-7a-1

• bta-let-7a-1: chr8: 87363854-87363933 [+]
• bta-let-7f-1: chr8: 87364207-87364293 [+]
• bta-let-7d: chr8: 87366413-87366499 [+]

Database links

• EntrezGene:MIRLET7A-1
• RNAcentral:URS00005EB5B7_9913
• miRBase Tracker:MI0005057

Mature sequence bta-let-7a-5p

• Accession: MIMAT0003844
• Previous IDs: bta-let-7a
• Sequence: 6 - ugagguaguagguuguauaguu - 27
• Deep sequencing: 22388600 reads, 78 experiments
• Evidence: experimental; cloned [1]
• Predicted targets:
  • TargetScanVert:bta-let-7a-5p

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).