Stem-loop sequence sme-mir-749

AccessionMI0005175 (change log)
DescriptionSchmidtea mediterranea miR-749 stem-loop
Literature search

1 open access papers mention sme-mir-749
(2 sentences)

Stem-loop
             ---------      ---      --gu   g g      cu 
5' aucgcuggga         ugagcc   ucggug    ccg g ugcagg  u
   ||||||||||         ||||||   ||||||    ||| | ||||||  c
3' uagcgaccuu         gcuugg   agccac    ggc u augucc  a
             uccaccuua      uga      aguu   - g      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig5205: 50773-50864 [-]
intergenic
Database links

Mature sequence sme-miR-749

Accession MIMAT0004016
Sequence

4 - 

gcugggaugagccucgguggu

 - 24

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).