Stem-loop sequence mdo-mir-7

AccessionMI0005270 (change log)
DescriptionMonodelphis domestica miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   uuggccuaguucugugu  a     a       u      --     a 
5'                  gg agacu gugauuu guuguu  uuuag u
                    || ||||| ||||||| ||||||  |||||  
3'                  cc ucuga cacuaaa caacag  aaauc a
   -----------------  g     -       -      ca     a 
Get sequence
Deep sequencing
3642 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 127713720-127713796 [+]
sense
Database links

Mature sequence mdo-miR-7

Accession MIMAT0004086
Sequence

17 - 

uggaagacuagugauuuuguug

 - 38

Get sequence
Deep sequencing3617 reads, 5 experiments
Evidence by similarity; MI0000728
Predicted targets

References

1