Stem-loop sequence mdo-mir-107

AccessionMI0005286 (change log)
DescriptionMonodelphis domestica miR-107 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   cu   uuc      --c    u  c           c   u   g 
5'   ucu   ugcuuu   ggcu cu uacaguguugc uug ggc u
     |||   ||||||   |||| || ||||||||||| ||| ||| g
3'   aga   acgaaa   ucgg ga auguuacgacg aac uug g
   --   --u      cua    -  c           -   -   a 
Get sequence
Deep sequencing
207512 reads, 3.16e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 81981106-81981189 [+]
sense
ENSMODT00000009232 ; PANK1-202; intron 5
ENSMODT00000009234 ; PANK1-201; intron 7
Database links

Mature sequence mdo-miR-107

Accession MIMAT0004100
Sequence

53 - 

agcagcauuguacagggcuauca

 - 75

Get sequence
Deep sequencing207512 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1