Stem-loop sequence mdo-mir-137a

AccessionMI0005299 (change log)
DescriptionMonodelphis domestica miR-137a stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   -----------------      ug a     -  g 
5'                  cuuggg  g uaaua cg a
                    ||||||  | ||||| || u
3'                  gaauuc  u auugu gc u
   ggagcugaugcgcauaa      gu -     u  a 
Get sequence
Deep sequencing
74117 reads, 880 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 463982402-463982457 [-]
sense
ENSMODT00000028250 ; mdo-mir-137a-201; exon 1
Database links

Mature sequence mdo-miR-137a

Accession MIMAT0004110
Sequence

29 - 

uauugcuuaagaauacgcguag

 - 50

Get sequence
Deep sequencing74114 reads, 5 experiments
Evidence by similarity; MI0000163
Database links
Predicted targets

References

1