----------------- g - g
cuugggug auaaua cg a
|||||||| |||||| || u
GAAUUCGU UAUugu gc u
ggagcuGAUGCGCAUAA - u a
| Accession | MIMAT0004110 |
| Description | Monodelphis domestica mdo-miR-137a mature miRNA |
| Sequence | 29 - UAUUGCUUAAGAAUACGCGUAG - 50 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|