Stem-loop sequence mdo-mir-152

AccessionMI0005306 (change log)
DescriptionMonodelphis domestica miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

1 open access papers mention mdo-mir-152
(1 sentences)

Stem-loop 
     c              g  a    cc    ua a  c 
5' cc ggcccagguucugu au cacu  gacu  g cu u
   || |||||||||||||| || ||||  ||||  | ||  
3' gg ucggguucaagaca ua guga  cuga  c ga g
     u              g  c    --    -- -  g
Get sequence
Deep sequencing
61489 reads, 880 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 200362981-200363053 [-]
sense
ENSMODT00000034509 ; COPZ2-201; intron 2
ENSMODT00000015842 ; COPZ2-202; intron 3
Database links

Mature sequence mdo-miR-152-5p

Accession MIMAT0026671
Sequence

9 -  

agguucugugauacacuccgacu

 - 31

Get sequence
Deep sequencing543 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-152-3p

Accession MIMAT0004117
Sequence

47 -  

ucagugcaugacagaacuuggg

 - 68

Get sequence
Deep sequencing60942 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

References

1
PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).