Stem-loop sequence mdo-mir-203

AccessionMI0005315 (change log)
DescriptionMonodelphis domestica miR-203 stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
   agcug   u    c         u    g    a    -   g 
5'      ccc gguc agugguucu aaca uuca cagu ucu u
        ||| |||| ||||||||| |||| |||| |||| |||  
3'      ggg cuag ucaccagga uugu aagu guua aga g
   -----   u    u         u    a    -    g   u 
Get sequence
Deep sequencing
2249 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 311187371-311187451 [-]
intergenic
Database links

Mature sequence mdo-miR-203

Accession MIMAT0004126
Sequence

53 - 

gugaaauguuuaggaccacuug

 - 74

Get sequence
Deep sequencing2242 reads, 5 experiments
Evidence by similarity; MI0000945
Database links
Predicted targets

References

1