Stem-loop sequence mdo-mir-216

AccessionMI0005320 (change log)
DescriptionMonodelphis domestica miR-216 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   --gaug   g  aa     u         cu   a        -au   a 
5'       gcu ug  uuggc uaaucucag  ggc acugugag   guu a
         ||| ||  ||||| |||||||||  ||| ||||||||   |||  
3'       cga ac  aaucg auuaggguc  cug ugacacuc   uaa u
   cuuuaa   g  -a     u         -u   g        ccu   a 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 638493848-638493944 [+]
intergenic
Database links

Mature sequence mdo-miR-216

Accession MIMAT0004131
Sequence

19 - 

uaaucucagcuggcaacugug

 - 39

Get sequence
Deep sequencing54 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Predicted targets

References

1