Stem-loop sequence mdo-mir-217

AccessionMI0005321 (change log)
DescriptionMonodelphis domestica miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   uu     c u  a  c     c          u  auaaua 
5'   gaugu g ag ua ugcau aggaacugau gg      u
     ||||| | || || ||||| |||||||||| ||       
3'   cuacg c uc gu acgua uccuugacua cc      u
   -u     a u  c  u     a          -  acggac 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 638507640-638507721 [+]
intergenic
Database links

Mature sequence mdo-miR-217

Accession MIMAT0004132
Sequence

14 - 

uacugcaucaggaacugauuggau

 - 37

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1