Stem-loop sequence mdo-mir-212

AccessionMI0005337 (change log)
DescriptionMonodelphis domestica miR-212 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop 
       -  c   c   -ca  u     cu      c      ccc     
5' gggc ag gcg cgg   cc uggcu  agacug uuacug   gggc 
   |||| || ||| |||   || |||||  |||||| ||||||   ||| c
3' cccg uc cgc gcc   gg acuga  ucugac aaugac   ccca 
       g  -   a   acc  c     cc      -      --u
Get sequence
Deep sequencing
5730 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 517587363-517587453 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-212
mdo-mir-212chr2: 517587363-517587453 [-]
mdo-mir-132chr2: 517586549-517586614 [-]
Database links

Mature sequence mdo-miR-212-5p

Accession MIMAT0026692
Sequence

16 -  

accuuggcucuagacugcuuacu

 - 38

Get sequence
Deep sequencing1498 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-212-3p

Accession MIMAT0004148
Sequence

56 -  

uaacagucuccagucacggcc

 - 76

Get sequence
Deep sequencing4232 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

References

1
PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).