Stem-loop sequence mdo-mir-132

AccessionMI0005338 (change log)
DescriptionMonodelphis domestica miR-132 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop 
       a         uuc          g g g 
5' gggc accguggcu   gauuguuacu u g a
   |||| |||||||||   |||||||||| | |  
3' cccg ugguaccga   cugacaaugg g c a
       c         cau          g a c
Get sequence
Deep sequencing
36372 reads, 460 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 517586549-517586614 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-132
mdo-mir-212chr2: 517587363-517587453 [-]
mdo-mir-132chr2: 517586549-517586614 [-]
Database links

Mature sequence mdo-miR-132-5p

Accession MIMAT0026693
Sequence

6 -  

accguggcuuucgauuguuacu

 - 27

Get sequence
Deep sequencing2867 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-132-3p

Accession MIMAT0004149
Sequence

42 -  

uaacagucuacagccauggucg

 - 63

Get sequence
Deep sequencing33498 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).