Stem-loop sequence mdo-mir-222a

AccessionMI0005347 (change log)
DescriptionMonodelphis domestica miR-222a stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   ----ugu    a     ucuuu  au   c     c 
5'        agau cuguc     cc  cag agcua a
          |||| |||||     ||  ||| |||||  
3'        ucua gguag     gg  guc ucggu u
   ucgagau    c     ucucu  --   a     c 
Get sequence
Deep sequencing
12201 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 17426716-17426783 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-222a
mdo-mir-222achr4: 17426716-17426783 [+]
mdo-mir-221chr4: 17427280-17427353 [+]
Database links

Mature sequence mdo-miR-222a

Accession MIMAT0004159
Sequence

27 - 

agcuacaucuggcuacugggucuc

 - 50

Get sequence
Deep sequencing12201 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1