Stem-loop sequence mdo-mir-367

Accession

MI0005375 (change log)

Description

Monodelphis domestica miR-367 stem-loop

Gene family

MIPF0000162; mir-367

Stem-loop

   -----           ca     -c      cu 
5'      acuguugcuaa  ugcaa  ucuguu  a
        |||||||||||  |||||  ||||||  u
3'      ugguaacgauu  acguu  gggcaa  g
   gguag           uc     aa      au 

Deep sequencing

4 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MonDom5; GCF_000002295.2): chr5: 66074337-66074399 [-]
• Overlapping transcripts:

  antisense

  ENSMODT00000007165 ; LARP7-201; intron 8

Clustered miRNAs

< 10kb from mdo-mir-367

• mdo-mir-302b: chr5: 66075008-66075078 [-]
• mdo-mir-302c: chr5: 66074864-66074922 [-]
• mdo-mir-302a: chr5: 66074649-66074718 [-]
• mdo-mir-302d: chr5: 66074486-66074556 [-]
• mdo-mir-367: chr5: 66074337-66074399 [-]

Database links

• EntrezGene:Mir367
• miRBase Tracker:MI0005375

Mature sequence mdo-miR-367

• Accession: MIMAT0004184
• Sequence: 38 - gaauugcacuuuagcaaugguga - 60
• Deep sequencing: 3 reads, 2 experiments
• Evidence: by similarity; MI0003531
• Predicted targets:
  • TargetScanVert:mdo-miR-367

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).