MIR675 is a long non-coding RNA (lncRNA) that has been studied in tumors. In a study, it was found that knockdown of MIR675 in tumors resulted in a significantly lower percentage of Ki67 positive cells compared to control tumors [PMC4741653]. However, the role of lncRNA H19 or MIR675 has not been investigated in patients with heterotopic ossification (HO) or mouse models of HO formation [PMC9753082].
u U A CC gacu cccaggg cUGG GCGG GAGGGC ACAGUG u ||||||| |||| |||| |||||| |||||| ggguccc gACU CGCC CUCCCG UGUCgc g c - A UA agug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004284 |
Description | Homo sapiens hsa-miR-675-5p mature miRNA |
Sequence | 10 - UGGUGCGGAGAGGGCCCACAGUG - 32 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
Accession | MIMAT0006790 |
Description | Homo sapiens hsa-miR-675-3p mature miRNA |
Sequence | 45 - CUGUAUGCCCUCACCGCUCA - 64 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|