miRBase entry: hsa-mir-934

Stem-loop hsa-mir-934


Accession
MI0005756
Symbol
HGNC: MIR934
Description
Homo sapiens hsa-mir-934 precursor miRNA
Gene family
MIPF0000542; mir-934

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR934 is a microRNA that has been studied for its role in various biological processes. One study found that a single nucleotide polymorphism (SNP) in MIR934, specifically n.15T>G in the 1st nucleotide in the 5p strand, resulted in altered DROSHA/DICER1 cleavage sites and the generation of a novel miRNA called isomiR [PMC9708458]. To validate the bioinformatics data for target prediction, luciferase assays were conducted to assess the interaction between MIR934 and two target genes, TFCP2L1 or RAB3B [PMC7295570]. In silico analysis and dual luciferase assays confirmed that MIR934 binds to specific sites on the 3'-UTR of FZD5, TFCP2L1, and RAB3B [PMC7295570]. The binding sites of MIR934 on FZD5 were found to be conserved across different species [PMC7295570]. Co-transfection experiments confirmed the binding of MIR934 to these target mRNAs [PMC7295570]. In another study, miR-934 knockdown was achieved using a MIR934 inhibitor to investigate its effect on cell proliferation and cell cycle in colorectal cancer (CRC) cells [PMC8809948]. The levels of circRNF10 and MIR934 were measured using specific primers [PMC9739140]. These findings highlight the functional significance of MIR934 and its potential role in various biological processes.

Literature search
5 open access papers mention hsa-mir-934
(8 sentences)

Sequence

297 reads, 11 reads per million, 43 experiments
agaaauaaggcuucUGUCUACUACUGGAGACACUGGuaguauaaaacccagagucuccaguaauggacgggagccuuauuucu
((((((((((((((((((((.((((((((((.((((...........)))).)))))))))).))))))))))))))))))))

Structure
                    C          A    uagu 
agaaauaaggcuucUGUCUA UACUGGAGAC CUGG    a
|||||||||||||||||||| |||||||||| ||||    u
ucuuuauuccgagggcaggu augaccucug gacc    a
                    a          a    caaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chrX: 136550878-136550960 [+]

Disease association
hsa-mir-934 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-934

Accession MIMAT0004977
Description Homo sapiens hsa-miR-934 mature miRNA
Sequence 15 - UGUCUACUACUGGAGACACUGG - 36
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043