MIR940 is a microRNA implicated in various cancer-related processes, including tumor progression and metastasis [PMC7072613]. It has been identified as a potential diagnostic biomarker for nasopharyngeal carcinoma (NPC) due to its high sensitivity and specificity [PMC7534087], [PMC6700302]. Research has shown that MIR940, along with other miRNAs, is involved in the regulation of gene expression by binding to the 3’-UTR of target mRNAs, influencing tumor cell viability and invasion [PMC6433657]. In the context of NPC, MIR940 has been highlighted for its diagnostic potential in plasma microarray data analyses [PMC7534087], [PMC6700302]. Additionally, MIR940 is involved in the regulation of osteogenesis in mesenchymal stem cells (MSCs) and has been studied for its role in promoting M2 phenotype polarization when expressed in exosomes from ovarian epithelial carcinoma cells [PMC7072613], [PMC8346509]. Furthermore, it is up-regulated in gastric cancer and contributes to cancer cell migration and invasion by targeting the tumor suppressor gene ZNF24 [PMC4944467]. These findings suggest that MIR940 could serve as a target for therapeutic intervention as well as a biomarker for various cancers.
a gu cccca - g g ag -- gug gug ggu gggcccgg ggagcgggg ccu g c cc cc u ||| ||| |||||||| ||||||||| ||| | | || || g cac cca uccgggCC CCUCGCCCC GGG C G gg gg u c -g ----- C A G AA aa agu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004983 |
Description | Homo sapiens hsa-miR-940 mature miRNA |
Sequence | 60 - AAGGCAGGGCCCCCGCUCCCC - 80 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|