Stem-loop sequence dme-mir-968

AccessionMI0005825 (change log)
DescriptionDrosophila melanogaster miR-968 stem-loop
Gene family MIPF0000865; mir-968
Literature search

1 open access papers mention dme-mir-968
(1 sentences)

Stem-loop
   -uga    a c   cuu        uc             uucucaa 
5'     ugga g uuc   aaguagua  cauuaaaggguug       c
       |||| | |||   ||||||||  |||||||||||||        
3'     accu c aag   uucaucau  guaguuuuccaac       a
   auug    - u   aau        --             uaaacgu 
Get sequence
Deep sequencing
5132 reads, 287 reads per million, 30 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 13747748-13747839 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-968
dme-mir-968chr2L: 13747748-13747839 [-]
dme-mir-1002chr2L: 13747609-13747697 [-]
Database links

Mature sequence dme-miR-968-5p

Accession MIMAT0005484
Previous IDsdme-miR-968
Sequence

16 - 

uaaguaguauccauuaaaggguug

 - 39

Get sequence
Deep sequencing3001 reads, 27 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-968-3p

Accession MIMAT0020865
Sequence

58 - 

accuuuugauguacuacuuuaa

 - 79

Get sequence
Deep sequencing2129 reads, 9 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).