Stem-loop sequence dme-mir-969

AccessionMI0005826 (change log)
DescriptionDrosophila melanogaster miR-969 stem-loop
Gene family MIPF0000879; mir-969
Literature search

1 open access papers mention dme-mir-969
(12 sentences)

Stem-loop
        cu        uc       c  uaag        gagaucgu 
5' agucu  guccuacg  cgaguuc ac    caaguuuu        u
   |||||  ||||||||  ||||||| ||    ||||||||         
3' ucagg  uagggugc  gcucgag ug    guucaaaa        u
        --        uu       u  caca        acaaaaau 
Get sequence
Deep sequencing
789 reads, 11.4 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 18124357-18124450 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-969
dme-mir-969chrX: 18124357-18124450 [+]
dme-mir-210chrX: 18128219-18128318 [+]
Database links

Mature sequence dme-miR-969-5p

Accession MIMAT0005485
Previous IDsdme-miR-969
Sequence

19 - 

gaguuccacuaagcaaguuuu

 - 39

Get sequence
Deep sequencing248 reads, 17 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-969-3p

Accession MIMAT0020866
Sequence

60 - 

aacuugacacguugagcucgu

 - 80

Get sequence
Deep sequencing529 reads, 28 experiments
Evidence not experimental

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).