Stem-loop sequence tae-MIR1118

AccessionMI0006180 (change log)
DescriptionTriticum aestivum miR1118 stem-loop
Literature search

4 open access papers mention tae-MIR1118
(5 sentences)

Stem-loop
   -   g --       -u       g  cu   uu  -    u  ag      uguuguaggcaaugauuguu 
5'  gaa c  acgugga  agaggaa ca  aca  au ggaa gg  ggagua                    u
    ||| |  |||||||  ||||||| ||  |||  || |||| ||  ||||||                    g
3'  cuu g  uguauuu  uuuccuu gu  ugu  ua ucuu cu  ucucgu                    c
   g   g uu       uu       -  -c   uu  g    u  gg      ccuagauauuuuagaaguuc 
Get sequence
Deep sequencing
14179 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR502 in [1]. miR1118 is unrelated to mammalian miR-502;

Genome context
Coordinates Overlapping transcripts
3A: 117818485-117818624 [-]
intergenic
Database links

Mature sequence tae-miR1118

Accession MIMAT0005353
Sequence

22 - 

cacuacauuauggaauggaggga

 - 44

Get sequence
Deep sequencing12923 reads, 116 experiments
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).