Stem-loop sequence tae-MIR1122a

AccessionMI0006184 (change log)
Previous IDstae-MIR1122
DescriptionTriticum aestivum miR1122 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

7 open access papers mention tae-MIR1122a
(34 sentences)

Stem-loop
   ------------------------------------------------------------------------------------------------------------------------auaaguacucccucuguuccuaa                    a     g        u     a     u       a   - aug 
5'                                                                                                                                                auacucccuccgucccaaaa uuuug cuuagauu gucua auacg auguauc agu c   u
                                                                                                                                                  |||||||||||||||||||| ||||| |||||||| ||||| ||||| ||||||| ||| |    
3'                                                                                                                                                uaugagggaggcaggguuuu agaac gaaucuaa cagau uaugc uacauag uua g   u
   accaugugggagacaaggauuuauauacggaagaaucucuaaggugauaccugauguaugcuucauuuuacucacuuagaugugagauuuuauacagauauauguaggcauacaucaaacaucaccuuagagauuuuucugaa                    a     a        u     c     c       a   u auu 
Get sequence
Deep sequencing
197664 reads, 106 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR506 in [1]. miR1122 is unrelated to mammalian miR-506;

Genome context
Coordinates Overlapping transcripts
4B: 268039586-268039880 [-]
intergenic
Database links

Mature sequence tae-miR1122a

Accession MIMAT0005357
Previous IDstae-miR1122
Sequence

96 - 

uagauacauccguaucuaga

 - 115

Get sequence
Deep sequencing1459 reads, 116 experiments
Evidence experimental; cloned [1], RTPCR [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).