Stem-loop sequence tae-MIR1124

AccessionMI0006186 (change log)
DescriptionTriticum aestivum miR1124 stem-loop
Literature search

1 open access papers mention tae-MIR1124
(2 sentences)

Stem-loop
   au   a   c  aaaggaa     c   ga     auc  uc    a   cgccacgccauugucg 
5'   uac uga uc       cggcc ugg  gcucg   cu  ucac ucc                c
     ||| ||| ||       ||||| |||  |||||   ||  |||| |||                g
3'   aug gcu ag       gccgg acc  ugagc   ga  agug agg                u
   uc   -   c  aucgaag     a   --     ---  ga    c   acgcagcaccccuacc 
Get sequence
Deep sequencing
78 reads, 0 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR508 in [1]. miR1124 is unrelated to mammalian miR-508;

Database links

Mature sequence tae-miR1124

Accession MIMAT0005359
Sequence

83 - 

gcaggacgugaagagcgagucc

 - 104

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; cloned [1], RTPCR [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).