Stem-loop sequence tae-MIR1125

AccessionMI0006187 (change log)
DescriptionTriticum aestivum miR1125 stem-loop
Literature search

5 open access papers mention tae-MIR1125
(7 sentences)

Stem-loop
   u                           aac  c       a     a    a cg       -a   c 
5'  uuggccguaaauuuaaccaacgagacc   ug ggcggga caaaa uuau u  cugaauu  uau a
    |||||||||||||||||||||||||||   || ||||||| ||||| |||| |  |||||||  ||| a
3'  aacuggcauuuaaauugguuguucugg   ac ccgcccu guuuu gaua g  gacuuaa  aua a
   a                           cuu  a       c     g    c au       gc   a 
Get sequence
Deep sequencing
22141 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR509 in [1]. miR1125 is unrelated to mammalian miR-509;

Genome context
Coordinates Overlapping transcripts
1B: 93806865-93807004 [+]
intergenic
Database links

Mature sequence tae-miR1125

Accession MIMAT0005360
Sequence

16 - 

aaccaacgagaccaacugcggcgg

 - 39

Get sequence
Deep sequencing17995 reads, 116 experiments
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).