Stem-loop sequence tae-MIR1131

AccessionMI0006193 (change log)
DescriptionTriticum aestivum miR1131 stem-loop
Literature search

3 open access papers mention tae-MIR1131
(3 sentences)

Stem-loop
   ---------------------------------------                    --u    uuu 
5'                                        cauuaguaccgguucguggc   aacc   a
                                          ||||||||||||||||||||   ||||   g
3'                                        guaaucauggccaagcaccg   uugg   c
   accucccccgggucugacuguuguaggacggugguggga                    ugc    cca 
Get sequence
Deep sequencing
23082 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR515 in [1]. miR1131 is unrelated to mammalian miR-515;

Genome context
Coordinates Overlapping transcripts
1B: 17546649-17546748 [-]
intergenic
2B: 661638-661737 [+]
intergenic
2B: 14241185-14241284 [-]
intergenic
2B: 69939927-69940026 [-]
intergenic
4B: 7633694-7633793 [-]
intergenic
5B: 89531304-89531403 [+]
intergenic
5B: 204872820-204872919 [-]
intergenic
6B: 69643208-69643307 [+]
intergenic
7A: 173702698-173702797 [-]
intergenic
Database links

Mature sequence tae-miR1131

Accession MIMAT0005366
Sequence

4 - 

uaguaccgguucguggcuaacc

 - 25

Get sequence
Deep sequencing7895 reads, 116 experiments
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).