Stem-loop sequence tae-MIR1133

AccessionMI0006195 (change log)
DescriptionTriticum aestivum miR1133 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

5 open access papers mention tae-MIR1133
(7 sentences)

Stem-loop
   -----     uua   a  gug    --     aucaua                      u      aagcuuguucc              c     - ua 
5'      acuuc   gug ua   guca  auuac      uacucccuccguccgaaaaagu uguccc           ucaaauggauguau uagca c  a
        |||||   ||| ||   ||||  |||||      |||||||||||||||||||||| ||||||           |||||||||||||| ||||| |   
3'      ugaag   cac au   uagu  uaaug      augagggagguaggcuuuuucg acaggg           aguuuacuuacaua aucgu g  c
   aucgu     uca   -  --a    uu     ------                      c      -----------              c     a uu 
Get sequence
Deep sequencing
17214 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR517 in [1]. miR1133 is unrelated to mammalian miR-517;

Genome context
Coordinates Overlapping transcripts
2D: 45939207-45939386 [+]
intergenic
Database links

Mature sequence tae-miR1133

Accession MIMAT0005368
Sequence

29 - 

cauauacucccuccguccgaaa

 - 50

Get sequence
Deep sequencing2367 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).