Stem-loop sequence tae-MIR1134

AccessionMI0006196 (change log)
DescriptionTriticum aestivum miR1134 stem-loop
Stem-loop
   ---------------------ccacgc      cau                         g aauggauuuggaggaggaggaggaggaggagcugcug 
5'                            guccgg   ucuucuucuucuuguuguuguuguu u                                     u
                              ||||||   ||||||||||||||||||||||||| |                                     u
3'                            cggguu   agaagaagaagaacaacaacaacga g                                     g
   auguacaacaacgucgacgucgaaguu      --u                         g aggaggcggcggaggaauaaacaacaugauccucgua 
Get sequence
Deep sequencing
5122 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR518 in [1]. miR1134 is unrelated to mammalian miR-518;

Database links

Mature sequence tae-miR1134

Accession MIMAT0005369
Sequence

124 - 

caacaacaacaagaagaagaagau

 - 147

Get sequence
Deep sequencing17 reads, 16 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).