Stem-loop sequence tae-MIR1135

AccessionMI0006197 (change log)
DescriptionTriticum aestivum miR1135 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

9 open access papers mention tae-MIR1135
(19 sentences)

Stem-loop
              a                u    u               a uaa 
5' cuacucccucc uucggaauuacuuguc cgga auggauguaucuaga c   a
   ||||||||||| |||||||||||||||| |||| ||||||||||||||| |    
3' gaugagggagg aagccuuaaugaacag gucu uaucuacauagaucu g   a
              c                c    u               - cau 
Get sequence
Deep sequencing
615839 reads, 1.85e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR519 in [1]. miR1135 is unrelated to mammalian miR-519;

Genome context
Coordinates Overlapping transcripts
1A: 203987144-203987252 [-]
intergenic
Database links

Mature sequence tae-miR1135

Accession MIMAT0005370
Sequence

78 - 

cugcgacaaguaauuccgaacgga

 - 101

Get sequence
Deep sequencing266422 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).