Stem-loop sequence tae-MIR1136

AccessionMI0006198 (change log)
DescriptionTriticum aestivum miR1136 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

11 open access papers mention tae-MIR1136
(17 sentences)

Stem-loop
                c                  u          c    ugua 
5' uacucccuccguu cgaauuacuugucgcagg auggauguau uaga    u
   ||||||||||||| |||||||||||||||||| |||||||||| ||||    u
3' augagggaggcaa guuuaaugagcagcgucu uaccuacaua aucu    u
                a                  u          a    ugau 
Get sequence
Deep sequencing
144312 reads, 267 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR520 in [1]. miR1136 is unrelated to mammalian miR-520;

Genome context
Coordinates Overlapping transcripts
6A: 4711016-4711122 [+]
intergenic
7D: 221246135-221246241 [-]
intergenic
Database links

Mature sequence tae-miR1136

Accession MIMAT0005371
Sequence

23 - 

uugucgcagguauggauguaucua

 - 46

Get sequence
Deep sequencing35726 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).