Stem-loop sequence tae-MIR1137a

AccessionMI0006199 (change log)
Previous IDstae-MIR1137
DescriptionTriticum aestivum miR1137 stem-loop
Gene family MIPF0000443; MIR1120
Literature search

7 open access papers mention tae-MIR1137a
(9 sentences)

Stem-loop
   --------cacgaugacgacgauuacauagccuugu               a          c   g         a 
5'                                     acucccuccguucca aauggaugac caa uuuguacua a
                                       ||||||||||||||| |||||||||| ||| |||||||||  
3'                                     ugagggaggcaaggu uuaucuacug guu aaacaugau g
   cuaaaaggaauagugaucguugcaacauaaugauga               c          a   g         u 
Get sequence
Deep sequencing
229979 reads, 759 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR521 in [1]. miR1137 is unrelated to mammalian miR-521;

Database links

Mature sequence tae-miR1137a

Accession MIMAT0005372
Previous IDstae-miR1137
Sequence

73 - 

uaguacaaaguugagucauc

 - 92

Get sequence
Deep sequencing8571 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).