Stem-loop sequence tae-MIR1139

AccessionMI0006201 (change log)
DescriptionTriticum aestivum miR1139 stem-loop
Gene family MIPF0000810; MIR1139
Literature search

7 open access papers mention tae-MIR1139
(12 sentences)

Stem-loop
   gccac     a       aua  c         acacauaucccuagaacuauauaacuaccuucauaguggguagcaacauaagugugguaucaugcaaagcuucauuua 
5'      agugg gaguaac   ca uaguaacau                                                                              u
        ||||| |||||||   || |||||||||                                                                               
3'      ucacc cucauug   gu aucauugua                                                                              u
   -----     -       -aa  u         gcuccucucuccaucaaacucauugaaucgaucaaugauauuguaguguacaggguuacguuauacucagauauugga 
Get sequence
Deep sequencing
13478 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR523 in [1]. miR1139 is unrelated to mammalian miR-523;

Genome context
Coordinates Overlapping transcripts
6B: 157622002-157622218 [-]
intergenic
Database links

Mature sequence tae-miR1139

Accession MIMAT0005374
Sequence

11 - 

agaguaacauacacuaguaaca

 - 32

Get sequence
Deep sequencing3848 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).