miRBase entry: hsa-mir-1299

Stem-loop hsa-mir-1299


Accession
MI0006359
Symbol
HGNC: MIR1299
Description
Homo sapiens hsa-mir-1299 precursor miRNA
Gene family
MIPF0000625; mir-1299

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1299 is a novel non-coding RNA (ncRNA) marker that has not been previously associated with any diseases, including cancer [PMC5354851]. This study is the first to report the expression of MIR1299 in ameloblastoma tumors [PMC5354851'>PMC5354851]. In addition to MIR1299, other miRNAs such as miR1256, miR205, miR4454, and miR548X were found to be overexpressed in ameloblastoma tumors [PMC5354851]. Furthermore, MIR1299 was found to be upregulated in both ASD and Non-TD subjects, along with other genes such as IGLV1-40, LRRC37A4P, PMCHL2CHL2, TRBV11-2 [PMC6814108]. In Non-TD subjects specifically, LRRC37AP, MIR1299 PMCHL2 and TRBV11-2 were among the top upregulated genes [PMC6814108'>PMC6814108]. Another study demonstrated the overexpression of MIR1299 in ameloblastomas using microarrays and suggested its potential role in the etiopathogenesis of this tumor [PMC7920560]. Additionally, MIR1299 was identified as one of the top genes depleted in a replicate screen along with FAM32A EIF3I BIRC2 BCL2 [PMC9402397]. Finally, based on NGS data from a previous study, MIR1299 was selected as a target for further miRNA analysis [PMC8744551].

References:
- PMC5354851
- PMC6814108
- PMC7920560
- PMC9402397
- PMC8744551

Literature search
9 open access papers mention hsa-mir-1299
(19 sentences)

Sequence

3343 reads, 43 reads per million, 88 experiments
ccucauggcaguguucuggaauccuacgugagggacaaucauucagacccacguagcagugUUCUGGAAUUCUGUGUGAGGGA
(((((..((((.((((((((((.(((((((.((..............)))))))))....)))))))))).)))).)))))..

Structure
--     ug    u          ---c       a  gacaau 
  ccuca  gcag guucuggaau    cuacgug gg      c
  |||||  |||| ||||||||||    ||||||| ||       
  GGAGU  UGUC UAAGGUCUUg    gaugcac cc      a
AG     -G    U          ugac       -  agacuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 40929010-40929092 [-]

Disease association
hsa-mir-1299 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1299

Accession MIMAT0005887
Description Homo sapiens hsa-miR-1299 mature miRNA
Sequence 62 - UUCUGGAAUUCUGUGUGAGGGA - 83
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621