WARNING: This summary was generated by AI. MIR1299 is a microRNA that has recently been identified as a novel noncoding RNA marker, not previously associated with any diseases, including cancer [PMC5354851]. This microRNA has been reported for the first time to be expressed in ameloblastoma tumors, and it is overexpressed in these tumors alongside other miRNAs [PMC5354851]. The overexpression of MIR1299 is also observed in both Autism Spectrum Disorder (ASD) and Non-Typical Development (Non-TD) subjects, indicating its potential role in the etiopathogenesis of these conditions [PMC6814108]. Furthermore, MIR1299 is among the top upregulated genes in Non-TD subjects [PMC6814108]. The significance of MIR1299's overexpression in ameloblastomas has led to suggestions that it could serve as a valuable tumor marker for this type of tumor [PMC7920560]. Additionally, MIR1299 was identified as one of the top genes from a genetic screen indicating its potential importance in biological processes or disease states [PMC9402397]. However, the statement regarding MIR1299's selection for further analysis based on suppressed expression levels from Next Generation Sequencing (NGS) data cannot be confirmed with the provided references and should be omitted from the summary.
-- ug u ---c a gacaau ccuca gcag guucuggaau cuacgug gg c ||||| |||| |||||||||| ||||||| || GGAGU UGUC UAAGGUCUUg gaugcac cc a AG -G U ugac - agacuu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005887 |
| Description | Homo sapiens hsa-miR-1299 mature miRNA |
| Sequence | 62 - UUCUGGAAUUCUGUGUGAGGGA - 83 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|