MIR548N is a microRNA that has been found to exhibit vulnerability to mutation in certain regions of the genome [PMC6756205]. Somatic deletions of approximately 500 bp in chromosome 2, specifically in the PRKRA and MIR548N genes, have been detected in samples from patients with schizophrenia [PMC6756205]. In a study investigating genetic variants associated with uncertain significance, one variant was found to affect the region harboring MIR548N [PMC6375196]. MIR548N is part of a specific grouping of microRNAs that have not previously been associated with preterm birth, and there is limited information about their function in disease processes [PMC5429750]. In terms of genetic expression, there have been higher levels of miR548a, miR548aa, miR548ai, miR548ak, and MIR548N observed in term pregnancies compared to preterm births [PMC5429750]. The region containing MIR548N has also been associated with a variant within the PRKRA gene and a noncoding transcript [PMC4289690]. Additionally, MIR548N has been identified as one of several brain-enriched microRNA-coding long noncoding RNAs [PMC4468152]. The somatic deletion affecting PRKRA and MIR548N was found only in DNA from the prefrontal cortex and not in DNA from other tissues [PMC3897957].
-- A c a agguuggugCAAAAGUAAUUGUGG UUUUGU guu |||||||||||||||||||||||| |||||| ||| a uccaaccacguuuucauuaacgcc aaaacg uaa aa c a a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005916 |
Description | Homo sapiens hsa-miR-548n mature miRNA |
Sequence | 10 - CAAAAGUAAUUGUGGAUUUUGU - 31 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|