miRBase entry: hsa-mir-1307

Stem-loop hsa-mir-1307


Accession
MI0006444
Symbol
HGNC: MIR1307
Description
Homo sapiens hsa-mir-1307 precursor miRNA
Gene family
MIPF0000558; mir-1307

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1307 is a microRNA that has been found to be differentially expressed in various studies and is associated with different conditions and diseases, including schizophrenia (SCZ) [PMC5804029]. In a study on SCZ, MIR1307 showed a clear trend toward association with the same direction of effect in the data from the dorsolateral prefrontal cortex (DLPFC) [PMC5804029]. The expression of MIR1307 was found to be approximately threefold higher in controls compared to SCZ patients [PMC5804029]. MIR1307 has also been implicated in other diseases, such as ovarian cancer and gastric cancer [PMC8472271] [PMC7922229]. In ovarian cancer, MIR1307 was found to inhibit apoptosis by down-regulating the expression of ING5 [PMC8472271]. Additionally, MIR1307 has been proposed as a potential biomarker for patients who may benefit from certain chemotherapy regimens, such as FOLFIRINOX [PMC9764499] [PMC8602334]. It has also been associated with drug resistance in breast cancer and pancreatic ductal adenocarcinoma (PDAC) cells exposed to chemotherapy [PMC8076833] [PMC8602334]. The role of MIR1307 in mediating chemoresistance has been studied extensively, and it has been shown to affect sensitivity to platinum-containing regimens and DNA damage repair pathways [PMC8602334]. Furthermore, MIR1307 has been identified as a potential therapeutic target for SARS-CoV-2 infection prevention [PMC7354481].

Literature search
19 open access papers mention hsa-mir-1307
(53 sentences)

Sequence

89205 reads, 639 reads per million, 155 experiments
caucaagacccagcugagucacugucacugccuaccaaucUCGACCGGACCUCGACCGGCUcgucuguguugccaaucgACUCGGCGUGGCGUCGGUCGUGguagauaggcggucaugcauacgaauuuucagcucuuguucuggugac
(((((.(((..(((((((((..(((.((((((((.(.(((.(((((((.((.((.((((.(((..((......))..))).)))))).))..))))))).))).).))))))))...)))...))...)))))))...))).)))))..

Structure
--     a   -cc       ---  -ac   --c        c a   U       -A  U  A    C   uc  ug 
  cauca gac   agcugag   uc   ugu   acugccua c auc CGACCGG  CC CG CCGG Ucg  ug  u
  ||||| |||   |||||||   ||   |||   |||||||| | ||| |||||||  || || |||| |||  ||   
  guggu uug   ucgacuu   ag   acg   uggcggau g ugG GCUGGCU  GG GC GGCU Agc  ac  u
ca     c   uuc       uua  cau   uac        a a   U       GC  U  -    C   ua  cg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 103394253-103394401 [-]

Disease association
hsa-mir-1307 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1307-3p

Accession MIMAT0005951
Description Homo sapiens hsa-miR-1307-3p mature miRNA
Sequence 80 - ACUCGGCGUGGCGUCGGUCGUG - 101
Evidence experimental
Illumina [1], 454 [2]
Database links
Predicted targets

Mature hsa-miR-1307-5p

Accession MIMAT0022727
Description Homo sapiens hsa-miR-1307-5p mature miRNA
Sequence 41 - UCGACCGGACCUCGACCGGCU - 61
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  2. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621