miRBase entry: vvi-MIR169j

Stem-loop vvi-MIR169j


Accession
MI0006528
Description
Vitis vinifera vvi-MIR169j precursor miRNA
Gene family
MIPF0000037; MIR169_2

Literature search
8 open access papers mention vvi-MIR169j
(15 sentences)

Sequence

3724 reads, 251 reads per million, 2 experiments
gagaguggagugCAGCCAAGGAUGACUUGCCGGaauucacauauagaguggaaugaggcaauagaccggccucuucucauggugucccuggcagguuguccuuggcuaccuuucgcucucuu
((((((((((.(.((((((((((((((((((((....(((.(((.(((......(((((.........)))))..)))))))))...)))))))))))))))))))).).))))))))))..

Structure
--          u C                    aauu   a   a   uggaau     aau 
  gagaguggag g AGCCAAGGAUGACUUGCCGG    cac uau gag      gaggc   a
  |||||||||| | ||||||||||||||||||||    ||| ||| |||      |||||   g
  cucucgcuuu c ucgguuccuguuggacgguc    gug gua cuc      cuccg   a
uu          c a                    -ccu   -   -   ----uu     gcc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 16101917-16102038 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from vvi-MIR169j
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR169j

Accession MIMAT0005683
Description Vitis vinifera vvi-miR169j mature miRNA
Sequence 13 - CAGCCAAGGAUGACUUGCCGG - 33
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558