miRBase entry: vvi-MIR169u

Stem-loop vvi-MIR169u


Accession
MI0006535
Description
Vitis vinifera vvi-MIR169u precursor miRNA
Gene family
MIPF0000037; MIR169_2

Literature search
8 open access papers mention vvi-MIR169u
(15 sentences)

Sequence

149 reads, 11 reads per million, 2 experiments
aggguggaauUGAGUCAAGGAUGACUUGCCGuuauauauuugcagaagggcacgcaggggccuuuagcuauguguuaccggcaaguugacuugacucuguuuggcccucu
(((((.((((.((((((((...(((((((((..((((((..((..((((((.(....).)))))).)).))))))...)))))))))..)))))))).)))).)))))..

Structure
--     g    U        GAU         -uu      uu  ag      a g 
  agggu gaau GAGUCAAG   GACUUGCCG   auauau  gc  aagggc c c
  ||||| |||| ||||||||   |||||||||   ||||||  ||  |||||| |  
  ucccg uuug cucaguuc   uugaacggc   ugugua  cg  uuuccg g a
uc     g    u        -ag         cau      -u  -a      g g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 16409401-16409510 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from vvi-MIR169u
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR169u

Accession MIMAT0005690
Description Vitis vinifera vvi-miR169u mature miRNA
Sequence 11 - UGAGUCAAGGAUGACUUGCCG - 31
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558