miRBase entry: vvi-MIR395f

Stem-loop vvi-MIR395f


Accession
MI0006561
Description
Vitis vinifera vvi-MIR395f precursor miRNA
Gene family
MIPF0000016; MIR395

Literature search
6 open access papers mention vvi-MIR395f
(23 sentences)

Sequence

7055 reads, 475 reads per million, 2 experiments
guacccuagaguuccccugaccacuucacuggggaucuucucuaaugacuucccaCUGAAGUGUUUGGGGGAACUCcuggugucau
(.((((..((((((((((((.(((((((.((((((((.........)).)))))).))))))).))))))))))))..)).)))..

Structure
-- u  -  ua            c       c      -  uuc 
  g ac cc  gaguuccccuga cacuuca ugggga uc   u
  | || ||  |||||||||||| ||||||| |||||| ||   c
  c ug gg  CUCAAGGGGGUU GUGAAGU acccuu ag   u
ua -  u  uc            U       C      c  uaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6489542-6489627 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR395f
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395f

Accession MIMAT0005716
Description Vitis vinifera vvi-miR395f mature miRNA
Sequence 56 - CUGAAGUGUUUGGGGGAACUC - 76
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558