miRBase entry: vvi-MIR395j

Stem-loop vvi-MIR395j


Accession
MI0006565
Description
Vitis vinifera vvi-MIR395j precursor miRNA
Gene family
MIPF0000016; MIR395

Literature search
6 open access papers mention vvi-MIR395j
(23 sentences)

Sequence

7056 reads, 476 reads per million, 2 experiments
gcccccuagaguuccccugaccacuucacuggggaucuucuuuaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcuggugucau
....((..((((((((((((.(((((((.((((((((.........)).)))))).))))))).))))))))))))..))......

Structure
--gccc  ua            c       c      -  uuc 
      cc  gaguuccccuga cacuuca ugggga uc   u
      ||  |||||||||||| ||||||| |||||| ||   u
      gg  CUCAAGGGGGUU GUGAAGU auccuu ag   u
uacugu  uc            U       C      c  uaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6553026-6553111 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from vvi-MIR395j
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395j

Accession MIMAT0005720
Description Vitis vinifera vvi-miR395j mature miRNA
Sequence 56 - CUGAAGUGUUUGGGGGAACUC - 76
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558