miRBase entry: vvi-MIR399h

Stem-loop vvi-MIR399h


Accession
MI0006577
Description
Vitis vinifera vvi-MIR399h precursor miRNA
Gene family
MIPF0000015; MIR399

Literature search
4 open access papers mention vvi-MIR399h
(10 sentences)

Sequence

30 reads, 2 reads per million, 2 experiments
aggaauaacagugcaauccuccuuuggcagaaagaucaugcacaugcauacuucuguuuUGCCAAAGGAGAAUUGCCCUGccauucgcuc
..((((..(((.(((((.(((((((((((((((((..((((....))))...))).)))))))))))))).))))).)))..))))....

Structure
--ag    aa   u     c              -   -uc    a 
    gaau  cag gcaau cuccuuuggcagaa aga   augc c
    ||||  ||| ||||| |||||||||||||| |||   ||||  
    cuua  GUC CGUUA GAGGAAACCGUuuu ucu   uacg a
cucg    cc   C     A              g   uca    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 2983545-2983634 [+]
Clustered miRNAs
4 other miRNAs are < 10 kb from vvi-MIR399h
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR399h

Accession MIMAT0005732
Description Vitis vinifera vvi-miR399h mature miRNA
Sequence 60 - UGCCAAAGGAGAAUUGCCCUG - 80
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558