Stem-loop osa-MIR1429

Accession

MI0006969

Description

Oryza sativa osa-MIR1429 precursor miRNA

Literature search

6 open access papers mention osa-MIR1429
(8 sentences)

Sequence

547 reads, 387 reads per million, 2 experiments

GUAAUAUACUAAUCCGUGCAUccaucguauaucuuacacgucaugugaacgugcaucgguucauaauguuguguuuauaaauguuaaugguaugugugGUUGCACGGGUUUGUAUGUUGc
(((((((((.((((((((((.(((.((((((((..(((((.(((((((((........)))))).))).)))))..............))))))))))).)))))))))).)))))))))

Structure

         U          U   u        ------------uu     u   -      gug 
GUAAUAUAC AAUCCGUGCA cca cguauauc              acacg cau gugaac   c
||||||||| |||||||||| ||| ||||||||              ||||| ||| ||||||    
cGUUGUAUG UUGGGCACGU Ggu guguaugg              ugugu gua uacuug   a
         U          U   -        uaauuguaaauauu     u   a      gcu 

Annotation confidence High

Genome context

Chr8: 2036953-2037072 [-]

Mature osa-miR1429-5p

• Accession: MIMAT0009208
• Description: Oryza sativa osa-miR1429-5p mature miRNA
• Sequence: 1 - GUAAUAUACUAAUCCGUGCAU - 21
• Evidence: experimental ; Illumina [3-4]

Mature osa-miR1429-3p

• Accession: MIMAT0005963
• Description: Oryza sativa osa-miR1429-3p mature miRNA
• Sequence: 99 - GUUGCACGGGUUUGUAUGUUG - 119
• Evidence: experimental ; MPSS [1], Northern [1], cloned [2], Illumina [4]

References

1. PubMed ID: 18312648
   Identification of novel and candidate miRNAs in rice by high throughput sequencing
   Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK
   BMC Plant Biol (2008) 8:25


2. PubMed ID: 19903869
   Rice MicroRNA effector complexes and targets
   "Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y"
   "Plant Cell (2009) 21:3421-3435


3. PubMed ID: 18353984
   Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)
   "Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ"
   "Proc Natl Acad Sci U S A (2008) 105:4951-4956


4. PubMed ID: 19103661
   Characterization and expression profiles of miRNAs in rice seeds
   "Xue LJ, Zhang JJ, Xue HW"
   "Nucleic Acids Res (2009) 37:916-930