Stem-loop sequence osa-MIR444f

AccessionMI0006978 (change log)
DescriptionOryza sativa miR444f stem-loop
Gene family MIPF0000402; MIR444
Literature search

23 open access papers mention osa-MIR444f
(67 sentences)

Stem-loop 
   au  u    c     a      u          u         gg a   ca   cacaa  aa  cau      ac 
5'   gg ggca caagc ugaggu acaacugcau acuugcaag  a uca  agu     ga  ca   guuauu  a
     || |||| ||||| |||||| |||||||||| |||||||||  | |||  |||     ||  ||   ||||||   
3'   cc ccgu guucg acuccg uguugacgug ugaacguuc  u agu  uca     cu  gu   uaauag  a
   -g  u    c     a      u          u         uu c   -a   uacua  gg  aac      gu
Get sequence
Deep sequencing
4011 reads, 2.5e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR444f

Accession MIMAT0005976
Sequence

124 -  

ugcaguuguugccucaagcuu

 - 144

Get sequence
Deep sequencing3884 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).