Stem-loop sequence gma-MIR390b

Accession

MI0007215 (change log)

Description

Glycine max miR390b stem-loop

Gene family

MIPF0000101; MIR390

Literature search

20 open access papers mention gma-MIR390b
(78 sentences)

Stem-loop

       u    a          g       a   u a   --ug ug     au 
5' agaa cugu aagcucagga ggauagc ccg g uac    a  auuau  g
   |||| |||| |||||||||| ||||||| ||| | |||    |  |||||   
3' ucuu ggua uucgaguucu ucuaucg ggu c aug    u  ugaua  u
       c    c          a       c   u -   caua gu     cu 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr14: 46392430-46392532 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0007215

Mature sequence gma-miR390b-5p

• Accession: MIMAT0007361
• Previous IDs: gma-miR390b
• Sequence: 11 - aagcucaggagggauagcacc - 31
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence gma-miR390b-3p

• Accession: MIMAT0020935
• Previous IDs: gma-miR390b*
• Sequence: 68 - uacuuggcgcuaucuaucuuga - 89
• Evidence: experimental; SOLiD [3]

References

1. PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2. PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3. PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).