![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR390b |
|||||
Accession | MI0007215 (change log) | ||||
Description | Glycine max miR390b stem-loop | ||||
Gene family | MIPF0000101; MIR390 | ||||
Literature search |
![]()
20 open access papers mention gma-MIR390b | ||||
Stem-loop |
u a g a u a --ug ug au 5' agaa cugu aagcucagga ggauagc ccg g uac a auuau g |||| |||| |||||||||| ||||||| ||| | ||| | ||||| 3' ucuu ggua uucgaguucu ucuaucg ggu c aug u ugaua u c c a c u - caua gu cu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR390b-5p |
|
Accession | MIMAT0007361 |
Previous IDs | gma-miR390b |
Sequence |
11 - aagcucaggagggauagcacc - 31 |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence gma-miR390b-3p |
|
Accession | MIMAT0020935 |
Previous IDs | gma-miR390b* |
Sequence |
68 - uacuuggcgcuaucuaucuuga - 89 |
Evidence | experimental; SOLiD [3] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
3 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|