Stem-loop sequence gma-MIR171b

AccessionMI0007217 (change log)
DescriptionGlycine max miR171b stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

17 open access papers mention gma-MIR171b
(41 sentences)

Stem-loop 
   ---      c  c           a      a        caaccau 
5'    uagaca gg gugauauuggu cggcuc ucuuaauu       u
      |||||| || ||||||||||| |||||| ||||||||        
3'    guuugu uc cacuauaacua gccgag agaguuaa       a
   uuc      -  u           a      c        caacuau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 50115835-50115926 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR171b
gma-MIR171bchr4: 50115835-50115926 [+]
gma-MIR171rchr4: 50116148-50116249 [+]
Database links

Mature sequence gma-miR171b-5p

Accession MIMAT0017336
Sequence

6 -  

acggcgugauauugguacggcuc

 - 28

Get sequence
Evidence experimental; Illumina [2], SOLiD [3]

Mature sequence gma-miR171b-3p

Accession MIMAT0007363
Previous IDsgma-miR171b
Sequence

62 -  

cgagccgaaucaauaucacuc

 - 82

Get sequence
Evidence experimental; 454 [1], Northern [1], SOLiD [3]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3
PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).