![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171b |
||||||
Accession | MI0007217 (change log) | |||||
Description | Glycine max miR171b stem-loop | |||||
Gene family | MIPF0000104; MIR171_2 | |||||
Literature search |
![]()
17 open access papers mention gma-MIR171b | |||||
Stem-loop |
--- c c a a caaccau 5' uagaca gg gugauauuggu cggcuc ucuuaauu u |||||| || ||||||||||| |||||| |||||||| 3' guuugu uc cacuauaacua gccgag agaguuaa a uuc - u a c caacuau |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gma-miR171b-5p |
|
Accession | MIMAT0017336 |
Sequence |
6 - acggcgugauauugguacggcuc - 28 |
Evidence | experimental; Illumina [2], SOLiD [3] |
Mature sequence gma-miR171b-3p |
|
Accession | MIMAT0007363 |
Previous IDs | gma-miR171b |
Sequence |
62 - cgagccgaaucaauaucacuc - 82 |
Evidence | experimental; 454 [1], Northern [1], SOLiD [3] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
3 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|